1

If you look at the Coronavirus genome below, it contains poly-A region at the end. I know that the viral RNA contains a poly-A tail. But, the genome in GenBank is stored in cDNA format. That means the end should have poly-T instead of A. Can anybody help me to understand this, please ?

>MN988713.1 Wuhan seafood market pneumonia virus isolate 2019-nCoV/USA-IL1/2020, complete genome
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA
--------------------------------------------------------------------
GATCGAGTGTACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAAT
TTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAA
M__
  • 9,527
  • 3
  • 23
  • 44
L R Joshi
  • 709
  • 3
  • 11

2 Answers2

0

I figured out that it has to do with second strand of cDNA. Usually genbank sequences are equivalent to 5’ to 3’ strand of cDNA. This strand is generated using second strand synthesis enzyme.

L R Joshi
  • 709
  • 3
  • 11
0

No its definitely a poly-A tail for both the in situ virus and the cDNA sequence. It couldn't be a poly-T in situ because,

  1. the Ts are uracils (Us) because its an RNA virus. Thus if you substituted all the 'T's for 'U's you'd recover the in situ genome
  2. specifically its a positive single-stranded RNA virus and the cDNA isn't a reverse complement but the positive strand.

If you look at the poly-A together with the 5' capping then you get the idea its to assist translocation and transcription to the endoplasmic reticulum. The genome pulls a few tricks which make it a bit more complicated than that, but thats the gist.

M__
  • 9,527
  • 3
  • 23
  • 44